plvx ires mcherry expression vector  (TaKaRa)

Journal: Aging Cell

Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration

doi: 10.1111/acel.14165

Figure Lengend Snippet: ATF4 function is required for cell proliferation and survival in normal and stressed state. (a) Representative images of EdU and DAPI staining in above mentioned conditions. Cell proliferation is measured using EdU+ cells normalized to total DAPI. (b) Quantification of the percent EdU+ over total DAPI+ cells represented in a bar graph. (c) Representative images of cleaved Caspase 3 (cl‐Cas‐3) and DAPI staining in abovementioned conditions. Cell death is measured using cl‐Cas3+ cells normalized to total DAPI. (d) Quantification of percent cleaved caspase 3+ over total DAPI+ cells represented in bar graph. n = 5–6 biological replicates; Data are presented as mean ± SD (* p < 0.05, ** p < 0.01, and *** p < 0.001, **** p < 0.0001, One‐way ANOVA). (e) RT‐qPCR analysis in mentioned conditions for ATF4 targets involved in amino acid transport, tRNA aminoacylation, export, and one‐carbon metabolism. n = 3–6 animals; Data are presented as mean ± SD (* p < 0.05, ** p < 0.01, and *** p < 0.001, One‐way ANOVA). (f) Schematics indicating the binding of ATF4 in mouse embryonic fibroblasts as identified through ChIP on Chac1, Slc3a2, and Slc7a11 genes (Han et al., ). (g) ATF4 ChIP from shCtrl and shOpa1 KD neurosphere. (h) H3K4me3 ChIP from shCtrl and shOpa1 KD neurosphere. n = 3–6 animals; data are presented as mean ± SEM (* p < 0.05, ** p < 0.01, and *** p < 0.001, 2‐tailed Student's t test). ATF4 OE, ATF4 overexpression vector; scrmch, Lentivirus vectors shRNA scramble mCherry; shATF4, Lentivirus vectors shRNA to ATF4; shCtrl, Lentivirus vectors shRNA scramble control; shOPA1, Lentivirus vectors shRNA to OPA1.

Article Snippet: For ATF4 manipulation, pLVX‐scramble‐mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′‐CCAGAGCATTCCTTTAGTTTA‐3′) to generate pLV‐U6‐[shAtf4]‐mCherry were ordered from Vectorbuilder.

Techniques: Staining, Quantitative RT-PCR, Binding Assay, Over Expression, Plasmid Preparation, shRNA, Control

Journal: Life science alliance

Article Title: Differential roles of CTP synthetases CTPS1 and CTPS2 in cell proliferation.

doi: 10.26508/lsa.202302066

Figure Lengend Snippet: Figure 4. More CTPS2 than CTPS1 is required for proliferation of Jurkat cells. (A, B, C) CTPS1-deficient Jurkat cells infected with lentiviral expression vectors for CTPS1 or CTPS2 with mCherry as a reporter gene. Cells were then maintained in culture with or without cytidine. (A) Percentages (%) of mCherry-positive cells (left panel) and alive cells (right panel) based on FACS profiles. At day 0, 0.6%, and 0.46% of the cells infected with CTPS1 and CTPS2 were mCherry positive, respectively. (B) Western blots for CTPS1 and CTPS2 expression in Jurkat cell lysates at day 26. (C) Histogram profiles from FACS analyses of mCherry expression of cells during the culture without cytidine. (D, E, F, G) CTPS1-deficient Jurkat cells infected with high viral titers of lentiviral vectors for CTPS1 or CTPS2 expression with mCherry as a reporter gene allowing around 94% (CTPS1/CTPS2) and 70% (GFP–CTPS1/GFP–CTPS2) of mCherry-positive cells at

Article Snippet: Role of CTP synthetases in cell proliferation Minet et al. https://doi.org/10.26508/lsa.202302066 vol 6 | no 9 | e202302066 10 of 14 were verified by sequencing and inserted into a bicistronic lentiviral expression vector encoding mCherry as a reporter (pLVX-EF1α-IRESmCherry Vector, cat#631987; Clontech).

Techniques: Infection, Expressing, Western Blot